Biosettia, a better solution in life science

pLV-RNAi Protocols – Plasmid DNA Preparation

Plasmid DNA preparation and screening for oligo insertions.

1. Inoculate single colonies from pLV-RNAi plate into 6 ml of LB medium with 100 µg/ml of ampicillin in a 15-ml tube. Grow bacterial culture at 37°C for 20 hours in a floor shaker with 300 rpm.

Suggestion: The single oligonucleotide shRNA cloning strategy is very efficient; therefore picking 2-3 colonies for each shRNA clone for plasmid DNA purification should be fine.

 

2. Spin down whole 6-ml bacterial culture in a desktop centrifuge (e.g. Sorvall RT6000) at 4,000 rpm for 10 min. Discard the supernatant and start plasmid DNA purification.

Note: We have tested that growing bacteria in 6 ml of LB medium and shaking in a floor shaker with 300 rpm at 37°C for 20 hours gives a better yield of plasmid DNA. We recommend using bacteria strain LV101 or Stabl3 and Favorgen nucleic acid purification kits (Click here to view our RNA/DNA Purification Kits) to prepare high-yield and good-quality plasmid DNA for future experiments such as transfection and lentiviral production. In general, the DNA yield is around 30-50 µg for each miniprep. The yield and quality of miniprep plasmid DNA purified by using Favorgen plasmid DNA extraction mini kit (Catalog # FAPDE 001) is sufficient for generating 30 ml of lentivirus.

 

3. The shRNA sequence containing a BamH I (GGATCC) site inside the loop sequence. Therefore, restriction digestions by BamH I can be used to confirm the insertion of double-strand oligo in the pLV-RNAi vector. We recommend that the diagnostic digestion be performed with BamH I + Sac I. The patterns and expected sizes of the restriction fragments from each pLV-RNAi vector containing shRNA insertion are provided in Figure 5 and Table 1, respectively. The appearance of the fragment labeled as red in Table 1 in the restriction digestion indicates the presence of a shRNA insert in the vector.

Suggestion: DNA sequencing is recommended to ensure no mutations are present in the oligo insertion.

 

Figure 5. Patterns of fragments from BamHI + Sac I restriction digestion of the pLV-RNAi vectors with a 52-bp shRNA insertion. The 56-nt oligo (AAAAGCAGTTATCTGGAAGATCAGGTTGGATCCAACCTGATCTTCCAGATAACTGC) as negative control was annealed and cloned into different pLV-RNAi vectors available from Biosettia (catalog # SORT-B01 to B36; C01 to C03) as the protocol described above. The recombinant plasmids were digested with restriction enzymes BamH I and Sac I. 0.5 µg of digested DNA was separated on 1% agarose gel and detected by staining with ethidium bromide. The expected sizes of fragments for each vector are listed in Table 1 below. The ones in red designate the diagnostic fragments for the presence of shRNA inserts in each vector.

 

Table 1. Expected sizes of restriction fragments generated by BamH I + Sac I digestion of each pLV-RNAi vector with a 52-bp shRNA insertion.