pLV-[mmu-miR-762] locker plasmid
pLV-[mmu-miR-762] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[mmu-miR-762] locker plasmid | |
Product Catalog Number | mir-mp0530 | |
miRNA Name | mmu-miR-762 | |
miRNA Accession | MIMAT0003892 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in mmu-miR-762 (GGGCUG) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
mmu-miR-762 | GGGGCUGGGGCCGGGACAGAGC | -- | ||||
mmu-miR-6911-5p | UGGGCUGAGUGGGUCUGUGGCAU | 50.0% | ||||
mmu-miR-6940-5p | AGGGCUGGCUGGAAGGUUUUUCG | 44.8% | ||||
mmu-miR-7028-5p | UGGGCUGAGGCUUGGGUCAGGAG | 70.8% | ||||
mmu-miR-7079-5p | AGGGCUGAGGCAGUGAGUCCUG | 56.0% | ||||
mmu-miR-7648-3p | AGGGCUGGGCCCGGGACGCGG | 70.8% | ||||
mmu-miR-7662-5p | AGGGCUGAGGCCUGGAUCCAGC | 72.7% |
Updating...