Biosettia, a better solution in life science

pLV-[mmu-miR-544-3p] locker plasmid

pLV-[mmu-miR-544-3p] locker plasmid

Product Details and Specifications
Product Name pLV-[mmu-miR-544-3p] locker plasmid
Product Catalog Number mir-mp0758
miRNA Name mmu-miR-544-3p
miRNA Accession MIMAT0004941
Plasmid Map Download
Shipping Conditions Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply.
Storage Conditions Store at -80 degrees Celsius
Protocol Download

\For your information: The seed sequence in mmu-miR-544-3p (UUCUGC) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.

miRNA anti-miR Sequence Percent similarity
mmu-miR-544-3p
AUUCUGCAUUUUUAGCAAGCUC --
mmu-miR-1904
GUUCUGCUCCUCUGGAGGGAGG 22.9%

Cat#: mir-mp0758
$ 525.00Price:
Loading Updating cart...
LoadingUpdating...