pLV-[mmu-miR-148a-3p] locker plasmid
pLV-[mmu-miR-148a-3p] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[mmu-miR-148a-3p] locker plasmid | |
Product Catalog Number | mir-mp0181 | |
miRNA Name | mmu-miR-148a-3p | |
miRNA Accession | MIMAT0000516 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in mmu-miR-148a-3p (CAGUGC) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
mmu-miR-148a-3p | UCAGUGCACUACAGAACUUUGU | -- | ||||
mmu-miR-152-3p | UCAGUGCAUGACAGAACUUGG | 81.8% | ||||
mmu-miR-148b-3p | UCAGUGCAUCACAGAACUUUGU | 90.9% | ||||
mmu-miR-1960 | CCAGUGCUGUUAGAAGAGGGCU | 48.1% |
Updating...