pLV-[hsa-miR-518a-3p] locker plasmid
pLV-[hsa-miR-518a-3p] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[hsa-miR-518a-3p] locker plasmid | |
Product Catalog Number | mir-hp0494 | |
miRNA Name | hsa-miR-518a-3p | |
miRNA Accession | MIMAT0002863 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in hsa-miR-518a-3p (AAAGCG) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
hsa-miR-518a-3p | GAAAGCGCUUCCCUUUGCUGGA | -- | ||||
hsa-miR-518f-3p | GAAAGCGCUUCUCUUUAGAGG | 77.3% | ||||
hsa-miR-518b | CAAAGCGCUCCCCUUUAGAGGU | 64.0% | ||||
hsa-miR-518c-3p | CAAAGCGCUUCUCUUUAGAGUGU | 61.5% | ||||
hsa-miR-518d-3p | CAAAGCGCUUCCCUUUGGAGC | 75.0% |
Updating...