pLV-[hsa-miR-302e] locker plasmid
pLV-[hsa-miR-302e] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[hsa-miR-302e] locker plasmid | |
Product Catalog Number | mir-hp0937 | |
miRNA Name | hsa-miR-302e | |
miRNA Accession | MIMAT0005931 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in hsa-miR-302e (AAGUGC) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
hsa-miR-302e | UAAGUGCUUCCAUGCUU | -- | ||||
hsa-miR-302a-3p | UAAGUGCUUCCAUGUUUUGGUGA | 69.6% | ||||
hsa-miR-302b-3p | UAAGUGCUUCCAUGUUUUAGUAG | 69.6% | ||||
hsa-miR-302c-3p | UAAGUGCUUCCAUGUUUCAGUGG | 69.6% | ||||
hsa-miR-302d-3p | UAAGUGCUUCCAUGUUUGAGUGU | 69.6% | ||||
hsa-miR-372-3p | AAAGUGCUGCGACAUUUGAGCGU | 60.9% | ||||
hsa-miR-373-3p | GAAGUGCUUCGAUUUUGGGGUGU | 52.0% | ||||
hsa-miR-520e | AAAGUGCUUCCUUUUUGAGGG | 56.5% | ||||
hsa-miR-519c-3p | AAAGUGCAUCUUUUUAGAGGAU | 37.0% | ||||
hsa-miR-520a-3p | AAAGUGCUUCCCUUUGGACUGU | 52.0% | ||||
hsa-miR-519b-3p | AAAGUGCAUCCUUUUAGAGGUU | 50.0% | ||||
hsa-miR-520b | AAAGUGCUUCCUUUUAGAGGG | 56.5% | ||||
hsa-miR-520c-3p | AAAGUGCUUCCUUUUAGAGGGU | 54.2% | ||||
hsa-miR-520d-3p | AAAGUGCUUCUCUUUGGUGGGU | 48.0% | ||||
hsa-miR-519a-3p | AAAGUGCAUCCUUUUAGAGUGU | 50.0% |
Updating...