pLV-[hsa-let-7f-5p] locker plasmid
pLV-[hsa-let-7f-5p] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[hsa-let-7f-5p] locker plasmid | |
Product Catalog Number | mir-hp0012 | |
miRNA Name | hsa-let-7f-5p | |
miRNA Accession | MIMAT0000067 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in hsa-let-7f-5p (GAGGUA) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
hsa-let-7f-5p | UGAGGUAGUAGAUUGUAUAGUU | -- | ||||
hsa-let-7a-5p | UGAGGUAGUAGGUUGUAUAGUU | 95.5% | ||||
hsa-let-7b-5p | UGAGGUAGUAGGUUGUGUGGUU | 86.4% | ||||
hsa-let-7c-5p | UGAGGUAGUAGGUUGUAUGGUU | 90.9% | ||||
hsa-let-7d-5p | AGAGGUAGUAGGUUGCAUAGUU | 86.4% | ||||
hsa-let-7e-5p | UGAGGUAGGAGGUUGUAUAGUU | 90.9% | ||||
hsa-miR-98-5p | UGAGGUAGUAAGUUGUAUUGUU | 86.4% | ||||
hsa-let-7g-5p | UGAGGUAGUAGUUUGUACAGUU | 90.9% | ||||
hsa-let-7i-5p | UGAGGUAGUAGUUUGUGCUGUU | 81.8% | ||||
hsa-miR-202-3p | AGAGGUAUAGGGCAUGGGAA | 52.0% | ||||
hsa-miR-4458 | AGAGGUAGGUGUGGAAGAA | 35.7% | ||||
hsa-miR-4500 | UGAGGUAGUAGUUUCUU | 63.6% |
Updating...