creative director San Diego Business Web Design Service & Online Internet Marketing and Advertising Using SEO Best Optimization Practices

Biosettia, a better solution in life science

SORT shRNA Vector Systems

Click on each tab to learn more:

Single Oligonucleotide RNAi Technology

Biosettia’s unique vector systems for gene silencing provide a time and cost saving method for delivering shRNA. Unlike other expression systems, which require two distinct sense/antisense shRNA oligos, only one palindromic oligo is required for annealing (Figure 1). The novelty of our pRNAi and pLV-RNAi vector systems offer users with several advantages over our competition:

Figure 2A. Distinct from other shRNA expression vectors currently available, only one DNA oligonucleotide is required for cloning a shRNA sequence into the pLV-RNAi vector.

  • Our pLV-RNAi vectors are ready to use:

    No restriction digestion or vector purification is required. Additionally, our pLV-RNAi vectors are self-inactivated (SIN) vectors, which carry a U3 deletion in its 3′ LTR, eliminating its promoter activity. This self-inactivating deletion provides an additional level of safety by preventing the integrated viral genome from generating full-length lentiviral RNA.


  • Reduced Cloning Complexity:

    Our single-strand DNA oligo encoding shRNA sequence is a perfect palindrome, thus (two) palindromic oligos can anneal to each other to form a double-stranded oligo. This eliminates the need to mix and anneal two different DNA oligos and reduces operational mistakes during the cloning process. The overall chance of mutations introduced during DNA oligo synthesis is reduced by 50%


  • Low Cost:

    Only one DNA oligo is required to generate an shRNA expression clone. This setup is the most economical, and is distinguishable from all the other shRNA vectors commonly used in academia and industry, for which two different oligos are needed to make an shRNA expression clone. Also, the length of the DNA oligo used for pLV-RNAi (52-56 nt) is shorter than the length of the DNA oligos required for most of the other commercially available shRNA vectors.


  • Highly Efficient, Low Background:

    The 5’-AAAA overhangs on annealed double-strand oligo can only be ligated to the 5’-TTTT overhangs on both ends of the linear pLV-RNAi vector. Unlike the overhangs generated by restriction digestion in other available shRNA expression vectors, these 5’-TTTT overhangs in pLV-RNAi will not self-ligate. As a result, the ligation of the double-strand oligo into the pLV-RNAi vector is highly efficient, and the contamination of empty, self-ligated pLV-RNAi vectors is greatly reduced (Figure 2).

  • Figure 2B. Special overhangs prevent self ligation for a more efficient cloning procedure.

  • Several Promoters to Choose From:

    Biosettia’s shRNAs can be expressed from human H1 (H1), human U6 (hU6), or mouse U6 (mU6) promoters in the pRNAi system. Researchers are able to choose the best suitable the pol III promoter for their model systems. In addition, our pLV-RNAi systems provide researchers the opportunity to select the pol II promoter of their choice.


  • Long Term Suppression:

    Biosettia’s pRNAi vectors encode antibiotics resistance markers for puromycin (Puro), hygromycin (Hyg), neomycin (Neo), or blasticidin (Bsd), allowing you to generate stable cell lines with long-term suppression of your genes.

Lentiviral-based shRNA Vector Systems

View Products Download Protocol Plasmid Maps Design shRNA

Our pLV-RNAi is a lentiviral-based RNAi vector system that allows efficient delivery of RNAi into cells via lentiviral transduction in some model systems where transfection is inadequate.

pLV-RNAi provides options for different RNA pol III promoters for shRNA expression and different selectable markers for establishing stable cell lines. In addition, this system offers a choice of various RNA pol II promoters, which drive different expression levels of selectable makers in the model system of your choice.

Our single-stranded oligonucleotide RNAi technology (SORT) for gene silencing delivers a unique feature in the construction of lenti-shRNA expression vectors.

Distinct from other shRNA expression vectors currently available, only one DNA oligonucleotide is required for cloning a shRNA sequence into the pLV-RNAi vector. The novelty of the pLV-RNAi vector system offers users with the advantage of lower cost, higher cloning efficiency, and less operational complexity over other shRNA expression systems.

Figure 2B. pLV-RNAi lentiviral-based shRNA vector

Product Components

Each pLV-RNAi kit provides a sufficient amount of reagents for 20 ligation reactions:

  • 20 ul pLV-RNAi (SORT-B) vector (10 ng/ul/rxn)
  • 20 ul pLV-RNAi (SORT-B) with sh-lacZ insertion as negative control* (1 ng/ul)
  • 30 ul Sequencing primer** (10 uM)
  • 100 ul 10× annealing buffer
  • *control sh-lacZ sequence: GCAGTTATCTGGAAGATCAGGTTGGATCCAACCTGATCTTCCAGATAACTGC
  • **sequencing primer: H1, AACGCTGACGTCATCAACCCGC; hU6, ATTTGCATATACGATACAAGGC; mU6, GAAGCTCGGCTACTCCCCTGCC; H1TO, AATATTTGCATGTCGCTATGTG.
  • Store the pLV-RNAi vector, negative control plasmid, sequencing primer at -20°C. Store the annealing buffer at room temperature. All reagents are guaranteed stable for 6 months when properly stored.

Inducible Lentiviral pLV-RNAi shRNA Vector Systems

View Products Download Protocol Plasmid Maps Design shRNA

Inducible pLV-RNAi vector system is designed to deliver gene silencing in a tightly regulated fashion in mammalian cell lines. The shRNA expression is suppressed by Tet repressor (TetR) binding to the hybrid H1 promoter containing tetracycline operators (TetO) and RNA interference only takes place in the presence of tetracycline. The inducible RNAi system provides the option of expressing shRNA in certain period of time.

Figure 3. A comparison between Biosettia’s pLV-RNAi & pLV-RNAi inducible shRNA vectors

Product Components

Each pLV-RNAi kit provides a sufficient amount of reagents for 20 ligation reactions:

  • 20 ul pLV-RNAi (SORT-C) vector (10 ng/ul/rxn)
  • 20 ul pLV-RNAi (SORT-C) with sh-lacZ insertion as negative control* (1 ng/ul)
  • 30 ul Sequencing primer** (10 uM)
  • 100 ul 10× annealing buffer
  • *control sh-lacZ sequence: GCAGTTATCTGGAAGATCAGGTTGGATCCAACCTGATCTTCCAGATAACTGC
  • **sequencing primer: H1, AACGCTGACGTCATCAACCCGC; hU6, ATTTGCATATACGATACAAGGC; mU6, GAAGCTCGGCTACTCCCCTGCC; H1TO, AATATTTGCATGTCGCTATGTG.
  • Store the pLV-RNAi vector, negative control plasmid, sequencing primer at -20°C. Store the annealing buffer at room temperature. All reagents are guaranteed stable for 6 months when properly stored.

Plasmid-based shRNA Vector Systems

View Products Download Protocol Plasmid Maps Design shRNA

Our pRNAi vector system is designed to facilitate the cloning of the double-strand DNA oligonucleotide encoding a stem-loop sequence, which is transcribed into shRNA by RNA polymerase III promoter (e.g. H1, human and mouse U6 promoters) once expressed in cells (Fig. 1). Our single oligonucleotide RNAi technology (SORT) for gene silence delivers a unique feature in the construction of shRNA expression vectors. Distinct from any other shRNA expression vectors currently available, only one DNA oligonucleotide is required for cloning a shRNA sequence into the pRNAi vector (see Product Advantages). The novelty of our pRNAi vector system benefits users with lower cost, higher efficiency, and reduced complexity.

Figure 1. pRNAi plasmid-based shRNA vector

Product Components

Each pRNAi kit provides a sufficient amount of reagents for 20 ligation reactions:

  • 20 ul pRNAi vector (10 ng/ul/rxn)
  • 20 ul pRNAi with sh-lacZ insertion as negative control* (1 ng/ul)
  • 30 ul Sequencing primer** (10 uM)
  • 100 ul 10× annealing buffer
  • *control sh-lacZ sequence: GCAGTTATCTGGAAGATCAGGTTGGATCCAACCTGATCTTCCAGATAACTGC
  • **sequencing primer: H1, AACGCTGACGTCATCAACCCGC; hU6, ATTTGCATATACGATACAAGGC; mU6, GAAGCTCGGCTACTCCCCTGCC.
  • Store the pRNAi vector, negative control plasmid, sequencing primer at -20°C. Store the annealing buffer at room temperature. All reagents are guaranteed stable for 6 months when properly stored.

Pre-designed shRNA Vector Kits

Search Predesigned shRNA Protocol for SORT-A Protocol for SORT-B/C

Biosettia’s pre-designed shRNA kits minimizes the time, effort, and guesswork associated with shRNA-based studies. Although our vectors are designed to be among the easiest and most efficient plasmids to use, our kits provide scientists with package that specifically target individual genes of interest. Each kit is guaranteed to contain at least one vector that will knock down target gene expression at the RNA level by at least 70 percent as measured by real-time qRT-PCR in stable cell lines after antibiotic selection or flow cytometric cell sorting (FACS)

Figure 4. Biosettia’s pre-designed shRNA kits provide 55 vector options to deliver shRNA of your interests targetting any human, mouse, and rat gene.
Search Predesigned shRNA

Product Components

Each pLV-RNAi kit provides a sufficient amount of reagents for re-transformation:

  • 20 ul shRNA-1 cloned into pLV-RNAi vector(> 100 ng/ul)
  • 20 ul shRNA-2 cloned into pLV-RNAi vector(> 100 ng/ul)
  • 20 ul shRNA-3 cloned into pLV-RNAi vector(> 100 ng/ul)
  • 20 ul shRNA-4 cloned into pLV-RNAi vector(> 100 ng/ul)
  • 20 ul negative LacZ control(> 10 ng/ul)
  • 20 ul negative scramble control(> 10 ng/ul)

Positive Control shRNA

View Products

Biosettia has chosen effective shRNA for five genes to serve as positive controls for your experiments. We are able to clone these oligos into each of our SORT A, B, and C shRNA vectors, providing researchers a fast, easy, and cost-effective tool in testing shRNA efficacy.

Figure 5. Highly efficient shRNA were selected for Biosettia’s positive control kits. As numbered: 1)sh-eIF6#1, 2)sh-eIF6#2, 3)sh-PSMA1#1, 4)sh-PSMA1#2, 5)sh-PSMA6#1, 6)sh-PSMA6#2, 7)sh-Rad51#1, 8)sh-Rad51#2, 9)sh-scramble, 10)sh-TAK1#1, 11)sh-TAK1#2, 12)Mock

Product Components

Each positive control kit provides a sufficient amount of reagents for re-transformation:

  • 5ng plasmid DNA stored in 1ml glycerol stock for re-transformation