pLV-[mmu-miR-294-3p] locker plasmid
pLV-[mmu-miR-294-3p] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[mmu-miR-294-3p] locker plasmid | |
Product Catalog Number | mir-mp0145 | |
miRNA Name | mmu-miR-294-3p | |
miRNA Accession | MIMAT0000372 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in mmu-miR-294-3p (AAGUGC) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
mmu-miR-294-3p | AAAGUGCUUCCCUUUUGUGUGU | -- | ||||
mmu-miR-290a-3p | AAAGUGCCGCCUAGUUUUAAGCCC | 35.3% | ||||
mmu-miR-291a-3p | AAAGUGCUUCCACUUUGUGUGC | 86.4% | ||||
mmu-miR-292-3p | AAAGUGCCGCCAGGUUUUGAGUGU | 75.0% | ||||
mmu-miR-295-3p | AAAGUGCUACUACUUUUGAGUCU | 78.3% | ||||
mmu-miR-302a-3p | UAAGUGCUUCCAUGUUUUGGUGA | 70.8% | ||||
mmu-miR-350-5p | AAAGUGCAUGCGCUUUGGG | 63.6% | ||||
mmu-miR-467a-5p | UAAGUGCCUGCAUGUAUAUGCG | 60.9% | ||||
mmu-miR-291b-3p | AAAGUGCAUCCAUUUUGUUUGU | 86.4% | ||||
mmu-miR-302b-3p | UAAGUGCUUCCAUGUUUUAGUAG | 66.7% | ||||
mmu-miR-302d-3p | UAAGUGCUUCCAUGUUUGAGUGU | 82.6% | ||||
mmu-miR-467c-5p | UAAGUGCGUGCAUGUAUAUGUG | 65.2% | ||||
mmu-miR-467d-5p | UAAGUGCGCGCAUGUAUAUGCG | 56.5% |
Updating...