Biosettia, a better solution in life science

pLV-[hsa-miR-934] locker plasmid

pLV-[hsa-miR-934] locker plasmid

Product Details and Specifications
Product Name pLV-[hsa-miR-934] locker plasmid
Product Catalog Number mir-hp0817
miRNA Name hsa-miR-934
miRNA Accession MIMAT0004977
Plasmid Map Download
Shipping Conditions Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply.
Storage Conditions Store at -80 degrees Celsius
Protocol Download

\For your information: The seed sequence in hsa-miR-934 (GUCUAC) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.

miRNA anti-miR Sequence Percent similarity
hsa-miR-934
UGUCUACUACUGGAGACACUGG --
hsa-miR-3618
UGUCUACAUUAAUGAAAAGAGC 50.0%

Cat#: mir-hp0817
$ 525.00Price:
Loading Updating cart...
LoadingUpdating...