pLV-[hsa-miR-920] locker plasmid
pLV-[hsa-miR-920] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[hsa-miR-920] locker plasmid | |
Product Catalog Number | mir-hp0811 | |
miRNA Name | hsa-miR-920 | |
miRNA Accession | MIMAT0004970 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in hsa-miR-920 (GGGAGC) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
hsa-miR-920 | GGGGAGCUGUGGAAGCAGUA | -- | ||||
hsa-miR-4300 | UGGGAGCUGGACUACUUC | 45.8% | ||||
hsa-miR-5591-5p | UGGGAGCUAAGCUAUGGGUAU | 48.1% | ||||
hsa-miR-6090 | GGGGAGCGAGGGGCGGGGC | 50.0% | ||||
hsa-miR-6726-5p | CGGGAGCUGGGGUCUGCAGGU | 68.2% | ||||
hsa-miR-6827-5p | UGGGAGCCAUGAGGGUCUGUGC | 33.3% |
Updating...