pLV-[hsa-miR-548c-5p] locker plasmid
pLV-[hsa-miR-548c-5p] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[hsa-miR-548c-5p] locker plasmid | |
Product Catalog Number | mir-hp0638 | |
miRNA Name | hsa-miR-548c-5p | |
miRNA Accession | MIMAT0004806 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in hsa-miR-548c-5p (AAAGUA) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
hsa-miR-548c-5p | AAAAGUAAUUGCGGUUUUUGCC | -- | ||||
hsa-miR-559 | UAAAGUAAAUAUGCACCAAAA | 39.3% | ||||
hsa-miR-548b-5p | AAAAGUAAUUGUGGUUUUGGCC | 90.9% | ||||
hsa-miR-548a-5p | AAAAGUAAUUGCGAGUUUUACC | 86.4% | ||||
hsa-miR-548d-5p | AAAAGUAAUUGUGGUUUUUGCC | 95.5% | ||||
hsa-miR-548j-5p | AAAAGUAAUUGCGGUCUUUGGU | 86.4% | ||||
hsa-miR-548k | AAAAGUACUUGCGGAUUUUGCU | 86.4% | ||||
hsa-miR-548l | AAAAGUAUUUGCGGGUUUUGUC | 86.4% | ||||
hsa-miR-548h-5p | AAAAGUAAUCGCGGUUUUUGUC | 90.9% | ||||
hsa-miR-548i | AAAAGUAAUUGCGGAUUUUGCC | 95.5% | ||||
hsa-miR-548w | AAAAGUAACUGCGGUUUUUGCCU | 91.3% | ||||
hsa-miR-548y | AAAAGUAAUCACUGUUUUUGCC | 86.4% | ||||
hsa-miR-548o-5p | AAAAGUAAUUGCGGUUUUUGCC | 100.0% | ||||
hsa-miR-548ab | AAAAGUAAUUGUGGAUUUUGCU | 86.4% | ||||
hsa-miR-548ak | AAAAGUAACUGCGGUUUUUGA | 86.4% | ||||
hsa-miR-548am-5p | AAAAGUAAUUGCGGUUUUUGCC | 100.0% | ||||
hsa-miR-548ap-5p | AAAAGUAAUUGCGGUCUUU | 81.8% | ||||
hsa-miR-548aq-5p | GAAAGUAAUUGCUGUUUUUGCC | 90.9% | ||||
hsa-miR-548ar-5p | AAAAGUAAUUGCAGUUUUUGC | 90.9% | ||||
hsa-miR-548as-5p | AAAAGUAAUUGCGGGUUUUGCC | 95.5% | ||||
hsa-miR-548au-5p | AAAAGUAAUUGCGGUUUUUGC | 95.5% | ||||
hsa-miR-548av-5p | AAAAGUACUUGCGGAUUU | 72.7% | ||||
hsa-miR-548ay-5p | AAAAGUAAUUGUGGUUUUUGC | 90.9% | ||||
hsa-miR-8054 | GAAAGUACAGAUCGGAUGGGU | 44.8% |
Updating...