pLV-[hsa-miR-548aj-3p] locker plasmid
pLV-[hsa-miR-548aj-3p] locker plasmid
Product Details and Specifications | ||
Product Name | pLV-[hsa-miR-548aj-3p] locker plasmid | |
Product Catalog Number | mir-hp1471 | |
miRNA Name | hsa-miR-548aj-3p | |
miRNA Accession | MIMAT0018990 | |
Plasmid Map | Download | |
Shipping Conditions | Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply. | |
Storage Conditions | Store at -80 degrees Celsius | |
Protocol | Download |
\For your information: The seed sequence in hsa-miR-548aj-3p (AAAAAC) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.
miRNA | anti-miR | Sequence | Percent similarity | |||
hsa-miR-548aj-3p | UAAAAACUGCAAUUACUUUUA | -- | ||||
hsa-miR-548d-3p | CAAAAACCACAGUUUCUUUUGC | 68.2% | ||||
hsa-miR-548j-3p | CAAAAACUGCAUUACUUUUGC | 81.8% | ||||
hsa-miR-548h-3p | CAAAAACCGCAAUUACUUUUGCA | 78.3% | ||||
hsa-miR-548x-3p | UAAAAACUGCAAUUACUUUC | 90.5% | ||||
hsa-miR-548z | CAAAAACCGCAAUUACUUUUGCA | 78.3% | ||||
hsa-miR-548ac | CAAAAACCGGCAAUUACUUUUG | 77.3% | ||||
hsa-miR-548ae | CAAAAACUGCAAUUACUUUCA | 90.5% | ||||
hsa-miR-548ah-3p | CAAAAACUGCAGUUACUUUUGC | 81.8% | ||||
hsa-miR-548am-3p | CAAAAACUGCAGUUACUUUUGU | 81.8% | ||||
hsa-miR-548aq-3p | CAAAAACUGCAAUUACUUUUGC | 86.4% |
Updating...