Biosettia, a better solution in life science

pLV-[hsa-miR-103a-3p] locker plasmid

pLV-[hsa-miR-103a-3p] locker plasmid

Product Details and Specifications
Product Name pLV-[hsa-miR-103a-3p] locker plasmid
Product Catalog Number mir-hp0080
miRNA Name hsa-miR-103a-3p
miRNA Accession MIMAT0000101
Plasmid Map Download
Shipping Conditions Shipped in 1ml glycerol stock at room temperature. Please note that additional shipping charges may apply.
Storage Conditions Store at -80 degrees Celsius
Protocol Download

\For your information: The seed sequence in hsa-miR-103a-3p (GCAGCA) has been found within the first 8 nucleotides of the following miRNA(s). Please note that there is a possibility that this mir/miR-locker may also inhibit the functions of miRNA(s) harboring the matched sequences in the model cells.

miRNA anti-miR Sequence Percent similarity
hsa-miR-103a-3p
AGCAGCAUUGUACAGGGCUAUGA --
hsa-miR-107
AGCAGCAUUGUACAGGGCUAUCA 95.7%

Cat#: mir-hp0080
$ 525.00Price:
Loading Updating cart...
LoadingUpdating...